Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12947E3
Clone ID IST12947E3
Vector VICTR76
Project tigm

Sequence tag IST12947E3HMF2
Sequence
TAAGTATAATTTATAAGTCCTTATGTTTTATAATCTTGCAATGCTTTCAATATAATGTGGAACATATTCTTCTCATTCAT
TACAGATTAAGATAAAATGTCTTTTAAGAAACTAAAGAGAACTATTTTTTCCTTTAGCTTTCGCAATATGTGAAACCAAA
GTATATATAATTTTAGACATATTTTATAAAGTGTGCCACCCATAGGGGTGTATAATCTGTAAGCGTTTGTGGAGTCCTAG
TCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 25581856..25582100 245
NO GENE  


Sequence tag IST12947E3HMR1
Sequence
TTTATAGGTAAAAATATTAGGAACACTTAATAGTTGGANTACATATTTAGTGTGAAGANTACAGANGN
Sequence Type genomic DNA
Unitrap ID UNI33888

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 25582098..25582161 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024837 (Dmrt1) NM_015826 doublesex and mab-3 related transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1354733]

 
Come back to gene ENSMUSG00000024837


For any suggestions or comments, please send an email to unitrap@crg.es