Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10064C10
Clone ID IST10064C10
Vector VICTR75
Project tigm

Sequence tag IST10064C10HMF1
Sequence
GGAGTCACCCAATGAGTCTAACCATCTTTGTTATAGATGGGAAAGTTGATTTTTTTAATAGTTATTGACATTAAACTCAG
TTCTTTTAACTTCCTTCCTGTTCTGTGTCCTTTATGATACAGTGTGCAAACTAAGCTTACTCTTAAAAGAAAGAGGGGCT
GGGGTAGAGGGTTTGCCTAGCAGGTATGAAGCACTAGGCTTGATCCCCAGTATATAGAAGACCAAGCAAGCAGAGTATAT
ATATACATATCATATAAAGTCATANATNAGCAACCAAGACATGGGTGTATGTCCATACNAAGGCTTGCACACGAGTGTTC
ATGGAAGTATTAANGTANANNAGGGANAATGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 70665370..70665721 336
NO GENE  


Sequence tag IST10064C10BBF1
Sequence
CTAATAATAATATTATTAATAATATGGGGAGCTGCTAATAGGACTTTATAAATTATTATATTTTTTTCGGGCAGGGACTC
CTCTAGCCCTGGTGGGTTTCAAACTTGCTATGTATCCAAGGATGACCTCCAATTTCCAATCCATCCCCCACCTCTCTACA
GAGTGCTGAGTTTAAGGTATGCACAATCTTGCTTGCTTTTATAAGGCCCTAAGGATGAAACCCAAGGCTCTGTGCATGTT
AGGCAGAGCCCTGAGATAATTCTTCCAACTGCGTGACAGTCCCATCTCTATAAGTTATTTTATAGCATTGATATTTATCA
AAGCTGTTACCAGTCGTGAAAACTTACTAGTGAGTCTTGTGACTAGCAACCTGCTTGAAAGAAATATATTTTCAGCTGGG
TGTGGTGGTGCACACTTTAGCTCTAGTACTTGGGAGGCACAGGCAGGTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI11215

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135175236..135175689 454
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es