Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14332C4
Clone ID IST14332C4
Vector VICTR74
Project tigm

Sequence tag IST14332C4BBF1
Sequence
TAAGTAAGCATTTTCTCACCGTGGAGGCCTCCAGGGAGCAGGACATCGGTATCCACAGGCAAGCAGGAGTACCTAGCAAC
CTAAAGGACAAGCACCCTAGAGAACAGCACCCTGGGAGGTAGACTTGCCTCTTCAATCGAGGGGATGCAGCCTCTCTAGG
GACTCCTTCGATGAGTCTTGTGCTTGCTACTCAGGTTAGTTGTCCTGAGCCCATAAAACTCCCCTGGACTCATCACGTGT
CCATGTCACCTGTTCTGCCNACCCCCGTCCTGCAGTGTACTGCANCTCTCTTGGCTGGATATAACTACTCCATTATAGAG
GTTANAGTGTGAGGCTCANNNATGTTTANTGACTCCCTTCAGGGTCNCACATCCTGCATANGCTGGGGCTGGGCTNANAG
CTTTTTTGTNTTGNNNAGAAAGCACTCCNNGCATTNCNANNGNCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 91651404..91651838 401
NO GENE  


Sequence tag IST14332C4HMR1
Sequence
NTGTAATGATCGGTTCTAAATGATAACCGTTTATGTTGCGTATGCATATTTGAAAGGTTAAAGGGCATTCACCTAATTGG
GAAGCTCAAGTGCTTGCTCTGGTTCGCGTGGCTGGAAAGACTCGTTTTGTTGTGGTTTCAGAGAAACTTATAGCGTCTTA
CAGTANCTAANATCAAAGAGCAGAGTTTGTGTTTTGTGACAGGGTCTGGTTAAGGAGCCTANAATGGTTAATANGTTNNC
CCAAGCTGGTTTCNAACTTGCCACTTGCNNCGGTTN
Sequence Type genomic DNA
Unitrap ID UNI20682

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96619386..96619659 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040433 (Zbtb38) NM_175537 zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]

 
Come back to gene ENSMUSG00000040433


For any suggestions or comments, please send an email to unitrap@crg.es