Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14560A11
Clone ID IST14560A11
Vector VICTR74
Project tigm

Sequence tag IST14560A11HMF1
Sequence
CTGTTTANNNNNGGTTATCTGAGATAGAGTTAAGCTCATAGACAAATAAATAGANNCANCTGGGGGNANGAGAAGGATTA
AATATGTTTATGGGAACAGAATTTTGGTATAAAAGAAAAACATTTTAAAATTGTCCTAAAAAGAATTAAGAACTGATACC
TTTCCCCTAAATTGTGAAAAATATTAATCTATGTATCTAACAAACTCAAAACCCTGTGAGTATAGTAACTGTAAACAGAA
TCACTGAAAATCAGAAAGATAATCTTCAAACCAACAAGACAAGGGATGTAGCTCAGTTGGTTGAATGCTTGCCTAGCATA
CACAAGGTCCTTGGTTCCATCCCCAACACAAGACAAAAATAAACAAAAGAAAAACAGGTACACACCTGTAATCCCACTAC
TGGGGAGGTGGAAATAGGAAGANCAGAAGTTCAGGGTCATCCTCAACTACAGANAGCTTGAAAAGTTCAAGANCAGCCTG
GGATATGTCTAACCCTGTATAAATAANCAAACACTAANTCCAGTGATGACTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108507847..108508378 500
 
EST/CDNA Est Name
  CF895920.1


Sequence tag IST14560A11HMR1
Sequence
ACAGTAGATGTCTGTTTTTTGTTTTTGTTGTTGTTTTTTGAGACAGGGTTTCTCTCTATAGCCCTGGCTGTCCTGGAACT
CACTCTGTANACCAGGCTGGCCTCGAACTCANAAATCCACCTGCCTCTGCCTCCCAAGTGCTGGGATTACAGGCATGCGC
CACCACACCCGGCTANATGTCTGTTTTATTTGGATTGTTTTGCTTATGGTAATGTTTTCAAGGCTCCATGTTGTANCATG
GGCATGTTTCCCANANTTTGTTATTTTTANACATTTCAAACAGGTTTCCTTTGTTCTTANCTAANTTACTGANACTTTAN
TCCCNATTTTCACTTTCTGTTTTTTTACTAAACTTTTATGGTCTCTTATTTATATANTTTTACNTATTCN
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108508375..108508763 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es