Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13992C5
Clone ID IST13992C5
Vector VICTR74
Project tigm

Sequence tag IST13992C5HMF2
Sequence
CCTGCAGGAAAAATGAAGATTTGGGTCCCTGTTTGTCCAATGACAACCTTGGCATCTCCTGTGGAGATGATGTAGCTAGC
TAAGCAACTTGCATTGTGAAAAGGTATTGTTACATAGAGTAGCAATATTAATACTCTCCAATGTTTAATCAGCACTTACT
GTATGCTGAGTTTATGCGAATGCAAATGCTGTACACGTATGTATTACCTCAGTCCCTACAAGTCTACTTGTCTGTTATTG
TTCTCATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132678547..132678796 250
NO GENE  


Sequence tag IST13992C5BBF1
Sequence
ATAGGTAGGACACATTCTTGGTTGAAGGCTCCCCTTGGAGTCTTGCCTGGCTACAGGAAGTGGCCTCTTCAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI13540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74025703..74025778 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034845 (Plvap) NM_032398 plasmalemma vesicle associated protein Gene [Source:MGI Symbol;Acc:MGI:1890497]

 
Come back to gene ENSMUSG00000034845


For any suggestions or comments, please send an email to unitrap@crg.es