Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14766F11
Clone ID IST14766F11
Vector VICTR76
Project tigm

Sequence tag IST14766F11HMR1
Sequence
GCACACTGTAGCTGTCTTCAAACACTCCAGAAGAGGGTGNCAGGGCCGGGCGTGGTGGCACACGCCTTTAATCCCAGCAC
TTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCCAC
ACANANAAACCCTGTTAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI31092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117545472..117545664 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025571 (Tnrc6c) NM_198022 trinucleotide repeat containing 6C Gene [Source:MGI (curated);Acc:Tnrc6c-001]

 
Come back to gene ENSMUSG00000025571


For any suggestions or comments, please send an email to unitrap@crg.es