Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10024F9
Clone ID IST10024F9
Vector VICTR75
Project tigm

Sequence tag IST10024F9HMF1
Sequence
TTTCTAGAACCCACTTGCTAAAAAGATGAGAAAAGACACTGCTCTTCAGCGATCTGCCAAGGCCCAGGTCTACCCTGGGG
TGACGTAAGTGACTGCTTTCTGAGGGAATCTCCCAATTGGCAATAAAGTAGATTGCCAATGATGCTCTGACAGTGATGCT
CTGACTGGACAGGTCTCTGTGGTGACTGCTGACCACACTGGAGATTAAAGCCTTCATAAATCCCCAAGCTCTTTCATGTA
TGCGTACACGGAGTCCCTGCTTCCTCTGCCCTACTTCCCTAAGTACCAACCTCATGTGCCCTTCCGCCCACCTGCTTGGG
CAGAAGACCAAAACAATCTTTGGGCCTTTGCCTTACCCCCAAAGTCCAGCCAGGGCAGGAGGGGGAGTGGTGAGGTCTCA
TCCAGGTACCAACTAGAGTCAGGCTATTTGAAACAGGACCATCTCTCCTATTGCTGAGTATCCAAGGAAACTTTAGCCTT
AACCCAATCAAAAAATTGAAGCTGAGGAAGGGAGGCACTTACAAGACAGGAGTCAGGTCCCACCAAGGAGTACTCTAGCT
TCAGGGAGTCATG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150784691..150785263 573
 
EST/CDNA Est Name
  BP766139.1 - BB646439.1 - BY747197.1 - CA569876.1 - BB630354.1 - CA565945.1 - BY248926.1 - CF164785.1 - AI876265.1 - BY007101.1 - BM951140.1 - CJ088756.1 - BY239949.1 - BQ442392.1 - BY030542.1 - BY003759.1 - BB864405.1 - BY333966.1 - CJ051536.1 - BY335833


Sequence tag IST10024F9BBF1
Sequence
TTTCTAGAACCCACTTGCTAAAAAGATGAGAAAAGACACTGCTCTTCAGCGATCTGCCAAGGCCCAGGTCTACCCTGGGG
TGACGTAAGTGACTGCTTTCTGAGGGAATCTCCCAATTGGCAATAAAGTAGATTGCCAATGATGCTCTGACAGTGATGCT
CTGACTGGACAGGTCTCTGTGGTGACTGCTGACCACACTGGAGATTAAAGCCTTCATAAATCCCCAAGCTCTTTCATGTA
TGCGTACACGGAGTCCCTGCTTCCTCTGCCCTACTTCCCTAAGTACCAACCTCATGTGCCCTTCCGCCCACCTGCTTGGG
CAGAAGACCAAAACAATCTTTGGGCCTTTGCCTTACCCCCAAAGTCCAGCCAGGGCAGGAGGGGGAGTGGTGAGGTCTCA
TCCAGGTACCAACTAGAGTCAGGCTATTTGAAACAGGACCATCTCTCCTATTGCTGAGTATCCAAGGAAACTTTAGCCTT
AACCCAATCAAAAAATTGAAGCTGAGGAAGGGAGGCACTTACAAGACAGGAGTCAGGTCCCACCAAGGAGTACTCTAGCT
TCAGGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150784691..150785256 566
 
EST/CDNA Est Name
  BP766139.1 - BB646439.1 - BY747197.1 - CA569876.1 - BB630354.1 - CA565945.1 - BY248926.1 - CF164785.1 - AI876265.1 - BY007101.1 - BM951140.1 - CJ088756.1 - BY239949.1 - BQ442392.1 - BY030542.1 - BY003759.1 - BB864405.1 - BY333966.1 - CJ051536.1 - BY335833


Sequence tag IST10024F9BBR1
Sequence
GAAAGAGCAAAGGCCTTGGCCCATATCCTGGAAGGTGAGAAGCAAGCCTTCAAAGGCAGAATGCTTAGTGTAGGTTTTAG
TCTCTGTGATGAAGCCAGAAATTAGATGTGAGCTCTGACTTCTCAGTTACCTGTCTCCAAGATCC
Sequence Type genomic DNA
Unitrap ID UNI154

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150784551..150784694 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010755 (Cars) NM_013742 cysteinyl-tRNA synthetase Gene [Source:MGI (curated);Acc:Cars-002]

 
Come back to gene ENSMUSG00000010755


For any suggestions or comments, please send an email to unitrap@crg.es