Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14060C8
Clone ID IST14060C8
Vector VICTR74
Project tigm

Sequence tag IST14060C8HMF1
Sequence
GTGGCTGTAAAGACCTCCCCCTCTCCCCGAACCCCCGCCCAGCAGTTGGTGCTTTGGTGTCCCCAGTGCTCCCTTGGAGT
CCCGACTTTGTGTCTGCCACATTCCTGGTACTGCTGGGAGGGGGCAGGCCCTTGGCTCCTCCTGAGTTCCCACGGGTGCG
TGGTCACTCTGTCCGCAGTCGCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI10463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 142916132..142916317 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056493 (Foxk1) NM_199068 forkhead box K1 Gene [Source:MGI Symbol;Acc:MGI:1347488]


Sequence tag IST14060C8BBF1
Sequence
GTGGCTGTAAAGACCTCCCCCTCTCCCCGAACCCCCGCCCAGCAGTTGGTGCTTTGGTGTCCCCAGTGCTCCCTTGGAGT
CCCGACTTTGTGTCTGCCACATTCCTGGTACTGCTGGGAGGGGGCAGGCCCTTGGCTCCTCCTGANTTCCCACGGGTGCG
TGGTCNCTCTGTCCGCAGTCGCTGTTGACAGTGGCTTGGGACTTGCTCTGGACTCCCTGGGCCTTTAAGTGTCNCAACAA
AAGANCTG
Sequence Type genomic DNA
Unitrap ID UNI10463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 142916132..142916378 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056493 (Foxk1) NM_199068 forkhead box K1 Gene [Source:MGI Symbol;Acc:MGI:1347488]

 
Come back to gene ENSMUSG00000056493


For any suggestions or comments, please send an email to unitrap@crg.es