Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13353A6
Clone ID IST13353A6
Vector VICTR74
Project tigm

Sequence tag IST13353A6BBF1
Sequence
GAATCCCCCTTTTANAATATTCGTGACGATGATAGCGGAGGAGTTGGGGTGCTCAGGTTGGAGCCCTTGGCCATGGAGAT
GGAAGGCGGGCAGCGGACGATGATCTGGATGGCTGCCATCTGCCATGAGGGGAGGATTTTTGAAGGTANCTAGGGATGAC
TGTCNCANANACTTCNNTTAATGCGCTTGGCGGGGGACTCTGTCNNTGGCGGAAGGGCNNANCNCATGNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13353A6HMF1
Sequence
AGTGTACTTACATATAATAAATAAATAAATCTTTA
Sequence Type genomic DNA
Unitrap ID UNI28087 UNI29896 UNI30969 UNI30970

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4570778..4570812 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3277501..3277535 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3282325..3282359 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020451 (Limk2) NM_001034030 LIM motif-containing protein kinase 2 Gene [Source:MGI (curated);Acc:Limk2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3449335..3449369 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3635730..3635764 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033781 (Asb1) NM_080857 ankyrin repeat and SOCS box-containing 1 Gene [Source:MGI (curated);Acc:Asb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 6197510..6197544 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072742 (AC157601.7-201) Alpha27-takusan [Source:UniProtKB/TrEMBL;Acc:A6NAU4]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3029121..3029155 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3014565..3014599 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3108863..3108897 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3104609..3104643 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3064037..3064071 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3237255..3237289 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026643 (Nmt2) NM_008708 N-myristoyltransferase 2 Gene [Source:MGI (curated);Acc:Nmt2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9213263..9213297 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3211819..3211853 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3147184..3147218 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4965617..4965651 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3024120..3024154 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3020539..3020573 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 5858077..5858111 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161875: 123724..123758 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166364: 152112..152146 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166452: 18241..18275 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166458: 3894..3928 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5755519..5755553 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 317992..318026 35
NO GENE  

 
Come back to gene ENSMUSG00000026643


For any suggestions or comments, please send an email to unitrap@crg.es