Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST423505
Clone ID OST423505
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST423505
Sequence
GACTGAGGCCTCATGAATCCATAGCAATGGCTCGATCAAGGGGTCCAATCCAGTCTTCAGGACCAACAATCCAGGATTAT
CTGAATCGACCAAGGCCTACCTGGGAGGAAGTCAAGGAACAGCTGGAAAAGAAAAAGAA
Sequence Type mRNA
Unitrap ID UNI18429

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3554637..3557779 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058503 (5830415L20Rik) NM_001042501 RIKEN cDNA 5830415L20 gene Gene [Source:MGI Symbol;Acc:MGI:1915402]

 
Come back to gene ENSMUSG00000058503


For any suggestions or comments, please send an email to unitrap@crg.es