Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12287C1
Clone ID IST12287C1
Vector VICTR76
Project tigm

Sequence tag IST12287C1HMF1
Sequence
CTTTCACGTTTAANTCCCCACACCCTGCTGATGGACTANCCCTTCCTGTCTGTGAGCTTGGNCCNATTATCCNTGCCGTT
TTCCCTAANAGAGGGANAACAGAGGCATCTGGGGAGAGACTTGGTCTGGGGCCTGCANAAAGGCTANACACGAGGATCCC
ANCTCCTTGCCCTGGAANAGCGGAGGAAACNGCNGGCAGCAGCTGCCAGTGCTGGCAAACCTCCAGCGCTCTGGGCTCAC
ACGGCTTGCTTGGCCCGTTTGTGCAGTTCCATCCTGGCAAGGGAGGAGCCAGAGTCTTGGTCTCCTAGTTGGGCCTCTCA
GGTCTGCATCCTGTGCTAAAAGCCCCAGGCCCAGCCNAACAAAATGGAGAGTCCAGGAAGCCNGCCNGCCTGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12287C1BBF1
Sequence
CTTTCACGTTTAAGTCCCCAGNCCCTGCTGATGGACTAGCCCTTCCTGTCTGTGAGCTTGGTCCCATTATCCAGTGCCGT
TTTCCCTAAGAGAGGGAGAACAGAGGCATCTGGGGAGAGACTTGGTCTGGGGCCTGCAGAAAGGCTAGACACGAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI32801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106519586..106519744 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es