Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14453B11
Clone ID IST14453B11
Vector VICTR74
Project tigm

Sequence tag IST14453B11HMR1
Sequence
TTATCTTTTATATTTCTATTTTCCTGGTTCTCTGTGAAGTGCTTTTATTACGAGTACTTANGAAACATCTGTTGAATGAA
TCGAGAGAGGTGGGGGAGAGATTATGGCACAAATACTGAACATATTGCTGGCACTACTTGGCAGTGAGGCAATGAGGTAC
AGGATGTGGTGTGAAAAGAGACAANATGAACGTGTGTGTGTGTGTTTTTTTCCCCCNNAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 57171994..57172209 208
NO GENE  


Sequence tag IST14453B11HMF1
Sequence
TTATTACTAGACATGGGATTTACATTGGAATGCTGGTTGTGGGTAGGACTAAGCTATGGAAAGCTTTGGATATTTAATAG
TTCATAAACTAAAGGTACAATCTAGCTAAATTGTTGAAGATATTAAAGATAAATAATATGTAAGTAGATTCTTAATGACA
ACAACAAGGCGTATATCTGTGCCATGGGTGCCANCTCACATANACACTTAGAGAGTATATCTGGGACTATTGAGAACATA
NTACTAGCATGTAGTGACTTAACANTNNNNCANTCATCTTTTGAN
Sequence Type genomic DNA
Unitrap ID UNI31050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 57171713..57171994 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022366 (BC026439) NM_172378 BC026439 proteinPutative uncharacterized proteincDNA sequence BC026439 ;; [Source:UniProtKB/TrEMBL;Acc:Q8R0S9]

 
Come back to gene ENSMUSG00000022366


For any suggestions or comments, please send an email to unitrap@crg.es