Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST423450
Clone ID OST423450
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST423450
Sequence
GAGGATGCTCCAGACCTTGTATGACTACTTCTGGTGGGAACGACTATGGCTGCCTGTGAACTTAACCTGGGCTGATCTAG
AAGACAAAGATGGACGTGTCTATGCCAAAGCCTCAGATCTCTACATCACACTCCCCCTGGCCCTGCTCTTTCTCGTCATT
CGATACTTCTTTGAGCTTTATGTGGCAACACCCCTGGCTGCCCTCCTGAATGTTAAGGAGAAAACCCGACTGCGGGCACC
TCCCAATGCCACCTTGGAACATTTCTACCAGACCAGCGGCAAGCAGCCCAAGCAGGTGGAGGTAGACCTTTTGTCACGGC
AGAGTGGGCTCTCTGGACGCCAGGTAGAACGCTGGTTCCGCCGCCGCCGCAACCAGGACAGGCCCAGTCTTCTCAAAAAG
TTCCGAGAAGCCAGCTGGAGATTCACGTATTACCTAATTGCCTTTGTTGCTGGCATGGCTGTCACTGTGGATAAACCCTG
GTTCTATGACTTAAGGAAAGTTTGGGAGGGATATCCCATACAGAGCATCATCCCTTCTCAGTATTTCCGGTGACTACAGA
Sequence Type mRNA
Unitrap ID UNI14367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95123982..95125518 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015714 (Lass2) NM_029789 LAG1 homolog, ceramide synthase 2 Gene [Source:MGI (curated);Acc:Lass2-001]

 
Come back to gene ENSMUSG00000015714


For any suggestions or comments, please send an email to unitrap@crg.es