Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14341C4
Clone ID IST14341C4
Vector VICTR74
Project tigm

Sequence tag IST14341C4BBF1
Sequence
ATTCTAAATATTTGCATGGCCTTTCTGTTCNCAAATTCTTATAATTCTTACCAACTTTTTCTTTGGTCCTGGTATATACC
ANGAAAAAAAAACTGCTCAAAATTTGCTGTGAAATATTGAGCAAGCCAATTGCCTTCTCTGAAACTTGATTCCTTTCACT
TTATTTATTTTTTTCTTTTGGCTTTTTTCNANACGGTTTCTCTGTATANCCCTGGCTGTCNAGGAACTCACTCTGTGGAC
CTCGAACTCTAAAATCTGCCTGCCTNNGCNNCCCAAGTGCTGGGATNANAGGCANGCGCCACCACTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14341C4HMR1
Sequence
NAATGATTTTTAAAAAAGAATTAAATGTTGACACATGCCTTATTTGCAGCACTTGGAAGCTGAGGTGANAGGATTGCTGT
GGACAAGTCANAGCTACACAGCANAATCCTTCTGTANAAAAAGAAGGTCCACATGCCNTATGGG
Sequence Type genomic DNA
Unitrap ID UNI11597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164649303..164649445 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017764 (Zswim1) NM_028028 zinc finger, SWIM domain containing 1 Gene [Source:MGI (curated);Acc:Zswim1-001]

 
Come back to gene ENSMUSG00000017764


For any suggestions or comments, please send an email to unitrap@crg.es