Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14975A7
Clone ID IST14975A7
Vector VICTR76
Project tigm

Sequence tag IST14975A7BBF1
Sequence
CAGGTAGGGTCAGAAGTTCAATGTCATCCTGGACTGCATAGAGTCCAAGGTCAGACTGGCCCACATGAGACTCTAACAAA
TGGGGGGGGGGGGNNNGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 146033157..146033249 93
NO GENE  


Sequence tag IST14975A7HMR1
Sequence
CCTGCCTCTGCCTTTCTAGTGCTGGAATTACAGGTGTACTCCACCACACAGGTATATGCTCACTCATAAGTGTGTGCCAC
CTGTGCCTTTCTAGCGTATCTGAACCAGTCTCTTCATCACCAAGAGTTAGGAGCGACCCTTCCTAGCCTTGAGCATAAGG
AGTTAGGAAGGATCCANAAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI1801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 146032978..146033160 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041775 (Mapk1ip1) NM_027115 mitogen-activated protein kinase 1 interacting protein 1 Gene [Source:MGI (curated);Acc:Mapk1ip1-001]

 
Come back to gene ENSMUSG00000041775


For any suggestions or comments, please send an email to unitrap@crg.es