Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13663H4
Clone ID IST13663H4
Vector VICTR74
Project tigm

Sequence tag IST13663H4HMF1
Sequence
GTTACAAGCTACCACAGAGATAGACTTGAACCTGAACAGGCAAAGCTGATCTTTTGTGATAGGAATCAGGGCAAAGGCTT
TTCCTTGGAGGAACAGGCAGGAAGACACACAACTGAACTTTCTTGGGAGGCAAAAATTAGCCTCAATGCTGATCTGTACG
GTGATCAGCAGTTTTTGTTTTGTTTTGATTTAAAGTTATCAGAACAATCAGGGTGTGTATTTACGATGCATACTTAATTG
TGTCTCTCAAGAAAGGTCACTAGCAGGGCATAGGAGATAGGAGGGTCAAAAAGTTCATTACTGCCGGGGCGTGGTGGTGC
ATGCCTTTAATCCCAGTACTCGGGAGGCAGANGCAGGCGGATTTCTGAGTTCTAGGCNNNCCTGGTCTACAAAGGGCTAC
ACAGANAANCCCTGTGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21260755..21261178 412
NO GENE  


Sequence tag IST13663H4HMR1
Sequence
GTAACCTGGGCCNCATGTCTGAGAAGANGTGCATGGCTCCAAGACAGCCATACTCTTCTCTCCCTCTTCTCCCCTCCCCC
CTCTGCCTTTGTAGACCAGGCTGGCCTGGAACTCACACCTGCCTCTGCCTCTGAGTGCTGGGAATAAAGGCCTGCGCCAC
CAATGCCTGGCAGCTATACTAATTTTTACACCTAGTTAGGGAGACCACACAGGGATAACTGTGGGCCAGCCATGCAGCAG
TGCTGATGGTGACCTAACTTGGGATTTTTGGCCTCTACATTAGCTGGTATAGGCATTANCCACCAT
Sequence Type genomic DNA
Unitrap ID UNI909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21261174..21261479 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es