Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14225F1
Clone ID IST14225F1
Vector VICTR74
Project tigm

Sequence tag IST14225F1BBF1
Sequence
TATGTNTNATAAGTCTTAAAGTATTAGCTGGGCCGATATCNNCCCTCTGTGCTACNCTGTCTACTTTCCTGTCAGTAACC
CCGANACATCACTTGCCACCTTCTGCCTGGGCTGCTCCTATGCCAACAGGTCCACCCCCGTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14225F1HMR1
Sequence
NNNNNNNCCCANNTTNNTCCCTCNNNCCNGANCCNNCTTANNNNNNNNTGGTGGGTCNGTGNGGGACTTACCTGAAAAGC
AATTTAAGAAACAGAAACCAAAGCCCAGGAGTGTAACTTCATAATGGTTTCCCACCTCCTTTAAATGACTGTTCTAGGTG
GGATCTGCACATGTGCTGCTGGAGTCAGACTTGCTCANTCTCCCTTCCCGCCAAANAAAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI1463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26718328..26718488 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001576 (Ergic1) NM_026170 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene [Source:MGI Symbol;Acc:MGI:1914708]

 
Come back to gene ENSMUSG00000001576


For any suggestions or comments, please send an email to unitrap@crg.es