Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST423267
Clone ID OST423267
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST423267
Sequence
GATTGAGGTACACAGGCTTGCAAAGCCTTTCTTTCCACCCTGAATGAGATGAATGACTACGCCGGGCAGCACGAGGTCAT
CTCTGAGAACATGACTGTCACAGATCACGGTGGACCTGATGCGCTACNGTTCAGGAGCTGAAGCAGGAGAGGAAATCGAA
CTTCCATGATGGACGGAAGGCTCAGCAGCACATAGAAACNGTGTTGGAAGCAACTGGAGTCAAGTAAGAGGAGGTTTGAG
CGGGACTGTAAGGAAGCCGACCGGGCACAGCAGTACTTCGAGAAAATGGACGCTGACATCAACGTGACCAAGGCGGATGT
GGAAAAGGAATTTGAGGAGTGCCAGAATCCAGAGACCCTGCTGGATTCCCCAACGGCCTCCCTTGCAGGGAAGTCAGGCC
CATCTGCCAGTTCCAGGGACAGACTGCCAAGCACTGCAGGGTCTGAGCAGCCTGAGCCGATGCTCCATGGAGCCCTACCC
CAGGCAGGGCGATGAGGGGCAGTGTGAGCTGCCTCTTCTTGCAATGTAAACCCCAGCCCAGGCCTTCCTGACAACC
Sequence Type mRNA
Unitrap ID UNI18444

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30921617..30951696 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es