Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST423229
Clone ID OST423229
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST423229
Sequence
GGAGAGACAGCCTAAAGACTGGGACTTCCTGGAGGATGGGGAGGAGAGAAATTGCACAGGGAAATTCTTCAAAAGGNGGT
AGNCAACCTNCCTGACCTTGACCTGCGACAGGGATTGCAGNCGAGAGGANACCCCAGAAACCANCGTNTAATGATAAGCA
AGAC
Sequence Type mRNA
Unitrap ID UNI13749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110323379..110324811 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032484 (Ngp) NM_008694 neutrophilic granule protein Gene [Source:MGI (curated);Acc:Ngp-001]

 
Come back to gene ENSMUSG00000032484


For any suggestions or comments, please send an email to unitrap@crg.es