Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10009B7
Clone ID IST10009B7
Vector VICTR75
Project tigm

Sequence tag IST10009B7BBF1
Sequence
TGACCTCCTCCTGGCCGAAGAACAAGGCCCAAAACAGGACCTTTCTCAGACACTGTGTTGCTTTGGCAGTTCCCAGGTGG
TACAGACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGCGACCGCTGCTC
Sequence Type genomic DNA
Unitrap ID UNI15140 UNI15225 UNI30676 UNI30806 UNI30809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4551067..4551218 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255759..5255910 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826619..7826770 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 11194931..11195082 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3110133..3110284 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3176895..3177046 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3871143..3871294 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11860559..11860710 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000065979 (C530044N13Rik) NM_146067 RIKEN cDNA C530044N13 gene Gene [Source:MGI Symbol;Acc:MGI:2443300]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11692272..11692423 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3031697..3031848 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 13845653..13845804 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6761691..6761842 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002107 (Cugbp2) NP_001103702 CUG triplet repeat, RNA binding protein 2 Gene [Source:MGI (curated);Acc:Cugbp2-009]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5055074..5055225 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12252668..12252819 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3987418..3987569 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4232519..4232670 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110616..5110767 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5270835..5270986 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4182998..4183149 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4906518..4906669 150
NO GENE  

 
Come back to gene ENSMUSG00000040407


For any suggestions or comments, please send an email to unitrap@crg.es