Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12551H1
Clone ID IST12551H1
Vector VICTR76
Project tigm

Sequence tag IST12551H1HMF1
Sequence
AGGAAAGCACTCTGCCACTGGGCCAAGGTATCCATATTATGTCATCCTTTAGAGGACTGCATCGTGTGGCTAGCCGCCCT
TCACCTGTGCCTCCTCCAACTGACGTACATGTAGACCTGTCCAGAGCTTCGCTGTATTTATCTGCCCTGCTGCTGGGGAA
GTCTTTGTAGCCACTCCTTTGGGCCNATGTTTCTGGAGGAGAAATTCCTAGAAGTGGGATCACTGGATCCAGAGCAGGTC
ACATTCTAAGTTAGGAGGGAGAGACTGCCAACCTGACTTCGGAGGAGGTGTGCCAGGTTGCACCCCATCANCCGTGCCCA
AGTGCCTGTGTCTCANACTCCTCGCCAAGAGCAGTGACTATNATAATAANCCTTGCAGTTTTGCCNGTTGANTTGGAAAA
TGGTGTCCNTGCTNNTTTGCATTTCTTCNNTTCGATCGGNGACTATCN
Sequence Type genomic DNA
Unitrap ID UNI28336

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6411066..6411512 421
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032946 (Rasgrp2) NM_011242 RAS, guanyl releasing protein 2 Gene [Source:MGI (curated);Acc:Rasgrp2-021]


Sequence tag IST12551H1BBF1
Sequence
AGGAAAGCACTCTGCCACTGGGCCAAGGTATCCATATTATGTCATCCTTTAGAGGACTGCATCGTGTGGCTAGCCGCCCT
TCACCTGTGCCTCCTCCAACTGACGTACATGTAGACCTGTCCAGAGCTTCGCTGTATTTATCTGCCCTGCTGCTGGGGAA
GTCTTTGTANCCACTCCTTTGGGCCAATGTTTCTGGAGGAGAAATTCCTAGAAGTGGGATCACTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI28336

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6411066..6411294 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032946 (Rasgrp2) NM_011242 RAS, guanyl releasing protein 2 Gene [Source:MGI (curated);Acc:Rasgrp2-021]

 
Come back to gene ENSMUSG00000032946


For any suggestions or comments, please send an email to unitrap@crg.es