Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14311H9
Clone ID IST14311H9
Vector VICTR74
Project tigm

Sequence tag IST14311H9BBF1
Sequence
TTTGCTCTTCCANNNNNNCGGANNNNNAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14311H9HMR1
Sequence
ANTTGGGTGTTCTTACCCACTGAGCCATCTCACCAGCCCCANAATTTTAATTTTAAATGAGTTATGTGGTTTGGTGTTGT
CTGCATGTGTGTCTGTATGAGGGTGTCATATCCCCTGGAACTAGAGTTACAGACAATTGTG
Sequence Type genomic DNA
Unitrap ID UNI13985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17198389..17198527 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]

 
Come back to gene ENSMUSG00000038965


For any suggestions or comments, please send an email to unitrap@crg.es