Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13787A1
Clone ID IST13787A1
Vector VICTR74
Project tigm

Sequence tag IST13787A1HMF1
Sequence
CTCTCCTGGAGGACTGTTCCTGTCTTCCNTAGCCNGGGATTTCAAAGCACAGTAGCACTAGTACAGTATCTTCGGTTATC
TCCGCCCACCGTCCTTGCGCACCAGCCTTCCTGCTGTCTGGGGCAGGGAAACTTCTCTCCACAACCCAGGCTGGGAANAG
CTATAGCCAAGCTCAAAAGCAAGGAAGCTTGGTTAATTTTAAGGGCCAGTATGTTC
Sequence Type genomic DNA
Unitrap ID UNI26390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108481770..108481984 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006675 (4933406E20Rik) NM_028944 RIKEN cDNA 4933406E20 gene Gene [Source:MGI Symbol;Acc:MGI:1921693]

 
Come back to gene ENSMUSG00000006675


For any suggestions or comments, please send an email to unitrap@crg.es