Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14635G8
Clone ID IST14635G8
Vector VICTR74
Project tigm

Sequence tag IST14635G8HMF3
Sequence
NTCNGGGATTTAAGAAACAAACAAATAAAGAGCTGAGGGTGGATAAATCAACACCCTGTGCCCCGTGACTATTGTAGAGC
ACTGATGAGGCTTCTAATCACCTTGGTTACATCAAGGCTCCGGTTCANGCTCAGGCCACAAAGAACATTTTAATTCTTTC
GTTTTAAACAGTTATCTCGATTTTGTGTGTATGGTTTTTTGGTTTTGTGGGGTTTTTNTGNNNGNTTGTTTTTGCCNGCA
TGTATCTCATGTATTGTGCACAAACAAGCAACAAGAGGGAATTANATTCTTTANAACTGGACTTGTGGGTGTTGTTAGCN
NTCACGTGGGTTCTGGGAACNNAATCTGGATCTTCTAAAAGATCANCAAGCGTTCTAATCTCCCAGCCATCTCTCCAACC
TCCATTTTTTTTTANTACTTTGATTTTACATCCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97147957..97148390 402
NO GENE  


Sequence tag IST14635G8BBF2
Sequence
GTCAGGGATTTAAGAAACAAACAAATAAAGAGCTGAGGGTGGATAAATCAACACCCTGTGCCCCGTGACTATTGTAGAGC
ACTGATGAGGCTTCTAATCACCTTGGTTACATCAAGGCTCCGGTTCAGGCTCAGGCCACAAAGAACATTTTAATTCTTTC
GTTTTAAACAGTTATCTCGATTTTGTGTGTATGGTTTTTTGGTTTTGTGGGGTTTTTTTGTTTGTTTGTTTTTGCCTGCA
TGTATCTCATGTATTGTGCACAAACAAGCAACAAGAGGGAATTAGATTCTTTANAACTGGACTTGTGGGTGTTGTTANCC
ATCACNTGGGTTCNGGGAACNAAANNNGNATCTNCTANNAGATNNNCANNCGTTCTAANCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14635G8HMR1
Sequence
NNNGCNTAAACAGCTTCAACCCNNTGGGAATGATACCTGGAATTCCCTANACAAATACATTGCTTTTCTAAAGATTAAGC
AGCATTTACACAGTCTAATAAAACCTGTTGCTCATCANATGTTCTGCAAAGCTAGAGAAAGGGTGAGGTTTCCTACATGC
TAAGAAAGCATTCTTCTAATGAATTATATCCTGGCCCTTTTTTTTATTATAAGACAGGGACCTAACTAANTTC
Sequence Type genomic DNA
Unitrap ID UNI24079

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 104492308..104492536 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044952 (Kctd21) NM_001039039 potassium channel tetramerisation domain containing 21 Gene [Source:MGI (curated);Acc:Kctd21-001]

 
Come back to gene ENSMUSG00000044952


For any suggestions or comments, please send an email to unitrap@crg.es