Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14926B6
Clone ID IST14926B6
Vector VICTR76
Project tigm

Sequence tag IST14926B6HMR1
Sequence
GGGGACGGTTTGCGCTTCGGTTTCCGGTCCTCCCTCGGTACTTCCCGGTGGTTCCGTCTTTCCCGCTTTCCTTTCCCTTC
CCCCGTTCAATTCGAG
Sequence Type genomic DNA
Unitrap ID UNI33119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 129626925..129627020 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037885 (Stk35) NM_001038635 serine/threonine kinase 35 Gene [Source:MGI (curated);Acc:Stk35-001]

 
Come back to gene ENSMUSG00000037885


For any suggestions or comments, please send an email to unitrap@crg.es