Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST423079
Clone ID OST423079
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST423079
Sequence
AGTTTCTGGCTGCTGCCAAGNAAGCTCTGCGAGAATCTCTTACAAACAGTTNATGCTGAGTATTCTAGATTTGTGAATCA
AATTAATACTGCTGTACCATTACCAGGCTATACACAACCCTCTGCTATAAGTAGTATCCCTCCTCAACCACCATATTATC
CATCCAATGGCTATCAGTCTGGTTACCCTGTTGTTCCCCCTCCTCAGCAGCCAGTTCAGCCTCCCTACGGAGTACCAAGC
ATAGTGCCACCAGCTGTTTCATTGGCACCTGGAGTCTTGCCAGCATTACCTACTGGGGTCCCACCTGTGCCAACACAGTA
TNCGATAACACAAGTGCAACCTCCAGCCAGCACTGGACAGAGCCCAATAAGTGCTCCTTTTATTCCTGCTGCTCCTGTCA
AAACTGCCTTGCCTACTGGCCCCCAGCCCCAGCCCCAACTCCCAGCTNAGCCACAGTNCACAGAANGAGGCGATTCACAG
AGGAGCTGCCTGATGAACGGGAT
Sequence Type mRNA
Unitrap ID UNI18454

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88502790..88512841 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028060 (2810403A07Rik) NM_028814 RIKEN cDNA 2810403A07 gene Gene [Source:MGI Symbol;Acc:MGI:1921450]

 
Come back to gene ENSMUSG00000028060


For any suggestions or comments, please send an email to unitrap@crg.es