Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10110G4
Clone ID IST10110G4
Vector VICTR76
Project tigm

Sequence tag IST10110G4BBF1
Sequence
TGATCCTTCCCCTTCCTTAACTTGTAGCAGATGCTTCGCTTTGCACTCCAAGCTACACACGTCTTCGTCCGTCTTGTCAC
AGATATACTCTCCATAACGACCGCAGACGACACATACAGGCTCCCCAGGCTCTGGCCACCGCTGGGTTTTAGAAAACGAC
TTTACAGGCTCTTCAGATGGGTGGCTGTCCTTCACACCCTCATCAGGTCCTGTGGAAGAAACCTCAGCCAACTGGCAAGA
AGGACTGTTGGTGCTTGATGCATGGCCGGGCTTGTCTGCTGTGACAGCTTCCTCAGTGACTGATGTGTGGACCGGAGTAT
CTCTGTCTCCCTCCACCTGAAGGCCTCCTGCTTCTGGCTTGCTTTTTTTAGCTTCACCGCTTTTGAGGTCATCATTAGAA
CTCCTCTTGATTTTCAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138313182..138313604 423
 
EST/CDNA Est Name
  AA462523.1 - BX511906.1


Sequence tag IST10110G4BBR1
Sequence
ATCATTAAGACCCAGCAGCCCACAGAGAGTGGCTGCCGAGCCAGAGTCCCCACTGGATGCCTTTTATGTCTACAAAGAGC
ACCCCTTTATTGTGACCCTCAAGGAGGACCAGATTGAAACCCTTAAACAGCAGCTAGGAATCTCAGTTCAAGGACAAGAC
GTTGCCAGGCCCATTATCGACTTCGAGCACTGTGGCTTCCCTGAGACCTTAAATCAGAACTTGAAGAAATCAGGCTACGA
AGTGCCAACCCCCATCCAGATGCAGATGATTCCTGTGGGGCTCCTGGGAAGGGACATTCTGGCCAGCGCTGACACTGGCT
CAGGGAAAACAGCTGCTTTTCTCCTGCCTGTTATTATCCGAGCTTTCTCTGAGGTAATTTACCAATCTGACATGTCTTCC
TCTCTGAAACAGACGCGGGATTTACCGAGTTTCATTGTGTGTAACTGATAAACTTGCACGCTGCTGCTTAGCATTTGCGA
ATTAAGTCACCAAGGTGCCGGTGACTTTGCTTTGTTTCGTGTGTGAAAAACATCACTTCAAAGAATATTCCTTTTATTGC
TGAACCAAAGATCC
Sequence Type genomic DNA
Unitrap ID UNI18641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138313601..138314172 569
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026404 (Ddx59) NM_026500 DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 Gene [Source:MGI (curated);Acc:Ddx59-001]

 
Come back to gene ENSMUSG00000026404


For any suggestions or comments, please send an email to unitrap@crg.es