Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST423054
Clone ID OST423054
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST423054
Sequence
ACTGAGGAGTGTATGGTGATGTACATCGAGTGAAGATTATGTTTAACAAGAAAGAAAACGCCTTGGTGCAGATGGCGGAT
GCGAGTCAAGCCCAGCTAGCAATGAACCACCTAAGTGGTCAGAGGCTCTATGGAAAAGTACTTCGGGCTACACTGTCCAA
ACATCAAGCCGTCCAGCTCCCTAGAGAGGGACAGGAAGACCAAGGTCTGACCAAGGACTTCAGCAATAGTCCCCTGCATC
GCTTTAAAAAGCCCGGCTCAAAGAATTTCCAAAATATCTTCCCTCCATCAGCCACACTTCATCTTTCCAACATTCCTCCT
TCTGTCACAATGGATGACCTGAAGAACCTGTTCACAGAAGCTGGATGCTCAGTGAAGGCTTTTAAGTTCTTCCAGAAAGA
CCGTAAGATGGCTCTCATTCAGTTGGGATCTGTGGAAGAAGCAATCCAGGCTCTTATTGAGCTTCACAATCATGACCTTG
GAGAGAATCACCACCTCAGAGTTTCCTTCTCAAAATCCACCCCCCCCCCCC
Sequence Type mRNA
Unitrap ID UNI18457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59489761..59495511 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028382 (Rod1) NM_144904 ROD1 regulator of differentiation 1 (S. pombe) Gene [Source:MGI (curated);Acc:Rod1-001]

 
Come back to gene ENSMUSG00000028382


For any suggestions or comments, please send an email to unitrap@crg.es