Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14653H2
Clone ID IST14653H2
Vector VICTR74
Project tigm

Sequence tag IST14653H2HMF1
Sequence
GGGAGAACACTGGAGAATAGAGCAAAGTTTTCAAAGAAAAAGGTAAAGTATGGATATCCCGCTGAGCAGCCANGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4089715..4089786 72
NO GENE  


Sequence tag IST14653H2HMR1
Sequence
CCTCCTCAGANTATCCCCAAAGGCTTCCCTCTCCCCAAACTTCTTTGTAGCTAGTACTTCAGTCACTGGAGAGCCTTCCT
CTTGCTGTAGTAGAAGTATCTTTAGATTTCCTATCCAGGACTGAGGTTTCTGCATCCACCACTTGAGTCAGGTCTCCCTC
ACAGCCACACTCGTAATGCAAGTCTCANCTTCTTTGTCTTTCATTTTCATATCCTACAGGCTANTCTCGGCCTCCAAGGG
AGGTGTTTCCTTTCATGCTCAGGTCTCTTCACTCCACACTANGAACTGATTCTGATTCTTTAAGCTGTTTGTTTTTGAGA
CNGGACTGTAACTTGTANCCCAGATGGGTATTGGANCTCCCANANNANTGCNGGCN
Sequence Type genomic DNA
Unitrap ID UNI36859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4089801..4090175 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035545 (Leng8) NM_172736 leukocyte receptor cluster (LRC) member 8 Gene [Source:MGI (curated);Acc:Leng8-001]

 
Come back to gene ENSMUSG00000035545


For any suggestions or comments, please send an email to unitrap@crg.es