Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10491A1
Clone ID IST10491A1
Vector VICTR76
Project tigm

Sequence tag IST10491A1HMR1
Sequence
CTCACATGCTCAGANGCTGTTTCTTCCCACAATGGCTGTCAGCAAGCTGGAGGACTAGAAACAAGTTGGCACTTAAGTCC
AAGAAACCGGAAGTCTCCGTACAGGATCCACCAATGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11782250..11782368 117
 
EST/CDNA Est Name
  BG409454.1


Sequence tag IST10491A1HMF1
Sequence
ATCCTANCTACTATCACTGTGCTATCAAACANATGACAGGGTTTGCCTCGGCCCTACCTGGAACTCCCATCATCTAACAA
CCATCTCACTGCCTAGTCTTCCTGTGCTTGATGCCCGTCTTGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 119881585..119881709 121
NO GENE  


Sequence tag IST10491A1BBF1
Sequence
TGAGTCAACCCAAAAAACCGCCTTTTGTAGTTAGAAGTATATGTATATGGTGGGCTTCACTCCTCCGGAAAGCCCTGAGT
AATCCCCCTTTGGCTACAGCTCCCCATCTGTCCCTGGTGTTTCAAAGTTGAGGGCAAACTTTTTTCCCCTATGCAGTACT
CTTGAATAAAAATCTGTCTTCCCATTTTAAAAAAGTGTCTGATGAATCATTTTGAACGCATTTAACATCACAAAATCTGT
CCAGCCCCCCTCCCATCCCAGACAATGGGGAGCATGGGGCAGTGCTGGGAACAGGACATGAAGGTCAGCTCCAATGCTAA
TCACAATGGATTTGACTCATCCCCANTACTTACTCTGATGGAAAATCCATCTTNNATTACNAAGCTCTGGACTNAGGGAG
GGATTTAGAAATGTATCCTTTGTTTANCTTTCAATTGTCTCTCACAAATTTAGCAACN
Sequence Type genomic DNA
Unitrap ID UNI17654

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11781797..11782253 445
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]

 
Come back to gene ENSMUSG00000020182


For any suggestions or comments, please send an email to unitrap@crg.es