Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14167G4
Clone ID IST14167G4
Vector VICTR74
Project tigm

Sequence tag IST14167G4HMF1
Sequence
AGATTTATTCATATATTTTATGCACGAGTACACCACCATTGTTCTCTTCAGAGACACCATAAGAGGGCACCAGACCCCAT
TATAGATGGTTGTGAGCCACCATGTGGTTGCTAGAAATTTAACTCAGGACCCCTCGAAAGAGCCATCAGTGCTCTTAACT
GCTAAGCCATTTCTCGGGCCTACTTGATTTAGGGCATATTCACATTTTTATCTGAGTGGGTCAGGGTGGATATCAGAATA
CAGTAATGGAGGATAGCCATTGTCACATCTTGAAAAGCACTAGCCTGCAAATACTTTAGCAGACATGTTTCATTGCCTTT
CTAAATACCACGCATATACAAAAGAAATCTCAACCCGGCTCAGACACTGCACCCACAAACTGCTGAATGCTCCCATATCA
ACAGCCAAGAAAATGTGTTACAGACTAATCTCAATGGGACCATTTTCTTAATCAGTCCTTTTCTCANGCAGTTCTACCAN
GACACTTTAAATAACAACNGGGCTCTGCATCTCCTGTGTCAGTATGTACAGANNCNCAATTNAAAGANTTTNNTATACTT
TGATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166889364..166889927 544
 
EST/CDNA Est Name
  BM932925.1 - BE859736.1 - BE134089.1 - CO038915.1 - CO044032.1 - CR521003.1 - AA820048.1 - AA470222.1 - AI847202.1 - AW123158.1 - BM021773.1 - BE992499.1 - BE945017.1 - BE992278.1 - BE992483.1 - BE992304.1 - BE996016.1 - BP771727.1


Sequence tag IST14167G4HMR1
Sequence
ATCTTACTCTTAAAAAAAGTAGGCCCGGGCTGGAGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTC
CAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCTTAACGAGATCTGACTCCCTCTTCTGGAGTGTCTGA
GGACAGCTACAGTGTACTTACATATAATAATAAATAAATAAATCTTTAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI2523

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166889924..166890146 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074578 (1500012F01Rik) NM_001081005 RIKEN cDNA 1500012F01 gene Gene [Source:MGI Symbol;Acc:MGI:1916199]

 
Come back to gene ENSMUSG00000074578


For any suggestions or comments, please send an email to unitrap@crg.es