Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14183C5
Clone ID IST14183C5
Vector VICTR74
Project tigm

Sequence tag IST14183C5HMF1
Sequence
NTTATAAAGTATAAAATCNTGGCATGTACACAAAAATANATGGAACGGGGGATTACTGTATTTANTGAACTGGGCCANAN
TCGNAATAANAAACTGTTTGTTTTCTCTCACTGGCANAACCTAANCNCAAATGTGTCCTGTGCNTCTGANANACAGANAC
CNNNGGACCGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14183C5BBF1
Sequence
NNNNNNANNNANAAAATCATGGCATGTACACAAAAATAGATGGAACGGGGGATTACTGTATTTAGTGAACTGGGCCAGAC
TCGGAATAAGAAACTGTTTGTTTTCTCTCACTGGCAGAACCTAAGCGCAAATGTGTCCTGTGCGTCTGAGAGACAGAGAC
CAATGGACCGTGTGAGAGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 105572249..105572420 172
NO GENE  


Sequence tag IST14183C5HMR1
Sequence
ATAACTGAAAAGATTCCTCTGTGTAAATGCACCACATTTTCTTTATTCATCCATCTGTTGGATATCTAGCTGGTTCTCTT
TCTGAACTGTTTTGACAGTAAAGCAATAAACGTGCATGTACAAATGTTTCTGTCTTATGTTGAGTTACAGTCCTTTTTGT
GTGTATACGCATGGTACCATTAGGCTTTTGAGGAACTTGACACTGACTTTCATAGGGGCTGCACCAATTTATATTTGTAC
CACCACTGAATAAGACTTANCACTTCACGTCCTCACCANCTTCTGGTTTCATTTGTTTCCTTCATCCTGACCATTCTGCT
TGGGGTGAGCCNNAACCTGNAANCCAACAGTTCATATAAACNCTTTCCTTATCTGCTGTACACGTTCTGTTTTGANANAA
AGCCTCTCACTGGACCTGN
Sequence Type genomic DNA
Unitrap ID UNI22553

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 105571824..105572241 400
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022119 (Rbm26) NM_134077 RNA binding motif protein 26 Gene [Source:MGI Symbol;Acc:MGI:1921463]

 
Come back to gene ENSMUSG00000022119


For any suggestions or comments, please send an email to unitrap@crg.es