Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14180H1
Clone ID IST14180H1
Vector VICTR74
Project tigm

Sequence tag IST14180H1HMF1
Sequence
NTACGAGATTTCTTATTATGCGTTTCCTACAATAATATGTAATCACTGACAGCCACTTTTCAGAGGGAAACACTAGAACA
AGTCAGGGCCGTCTGACTTCGGAGAGATACCATCTCGCTCCCAGGAAAGCCTAAAAAGCCACTAACCTGGGGACCCGCCA
GTTGCTTCCCTTCGTTTTCGACTTTCCCGCTAGAAGAACGGCGCTCTGACGCCATCAAAGCCGCGCCGTGGCGTGACGTT
ACTCGCCCGCACCGGAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 113481629..113481887 259
NO GENE  


Sequence tag IST14180H1HMR1
Sequence
AGATGAACAGTAAGATTCAGAGAAAGCAGGGCTTTGATAGGACTAGAGTATAGTTCACCTGTCGGGTAGTCTACAGCTGT
ATCATTTTAACTAAAGTAGATGCTGTAAAACTCAGTTGTCGGTCTCAACCCCCCCCCTTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI20161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150733642..150733784 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]

 
Come back to gene ENSMUSG00000059119


For any suggestions or comments, please send an email to unitrap@crg.es