Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14968C7
Clone ID IST14968C7
Vector VICTR76
Project tigm

Sequence tag IST14968C7HMF1
Sequence
CTCTGATACTCTACAAAAAGAATAGAGAAAACAGACACAACCTTCCTGGCAGCGCCATTTCCTGAGTGGAGCTAAGGCAC
TGGCAGGGAAACTCTAACAAGGGCATTTTCCTGTGGTTTCCATATANAAATCCTTTTTTTTAAAACAGGATTTTCTTTTC
TGTANCATTTTCCAACCAATAATAATGAANTAATAATCCCCCATCATCTAGGACATAGGTTCNCAACCAATGTTTGTACA
GCTCAATTCCCTGTGCTTCCCTATGTAANTCANTTCCATTGAAANANNCCNTCNTTAANTTNGGATACCNCCACACCNAT
TACANAANANAANCCTANCANANGANGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14968C7HMR1
Sequence
NANAAGANAACTGCAGGATTTCTACAGTGTGTACCTTACCTTATATATCTAATTATGGGGGTCAGAATTAGTCTGCTTGG
GAGGACTGACTAGCCAAGTCTCCTGCCAGTAAAACAACACCATACTGAGATTTGTAAAGATTAATAAAAGAAATACTANA
AGCCCTGCTCCCTTTTGGATTCCTAAACAATTCCCTGGTACAGTTGGTGCTTTTCTTTAAAATAAATGATTGTGTGTGCA
GCATTCTGTGAGTAAAACCTGGAACATTTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI35075

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 34104312..34104581 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038718 (Pbx3) NM_016768 pre B-cell leukemia transcription factor 3 Gene [Source:MGI (curated);Acc:Pbx3-001]

 
Come back to gene ENSMUSG00000038718


For any suggestions or comments, please send an email to unitrap@crg.es