Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15112H1
Clone ID IST15112H1
Vector VICTR80
Project tigm

Sequence tag IST15112H1BBF1
Sequence
GCCCTACTGACTTCTCTTTGTGTGTATATCTTTCTTTTCCTTATGAGCACAATATACTGAGGTAGATGGATTACCTAAAG
CATCAAGCACTGTCTGAATGGCCTGAGTGGCCATCTCCAACCTCCCCACGTGTTGTCCCCCATGAGTTCTCCACCTCATC
TTTCCCACCTTGGAATGCCTCAGGGAGTAACACTGACCTTCCGTTTCAGGATCTGCCATCGACTGGCGGGAACCCGAAGG
CAAGGAAGTATGGGATTATGTGACTGTCCGAAAGGATGCCCACATGTTCTGGTGGCTCTATTATGCCACCANCCCTTGCA
AGAACTTTTCANAGCTGCCCCTGGTCATGTGGCTTCAGGTACAGTAAAGTCTTCNCCTGGCCTCCAGGTCAGGTCTCCTT
TTAACCTCATTGNTTGGTTCNNANTTTCCAGCTNANNNNTGACTGACTNATTTTGGTCCNTCNNNTCCTGGGGC
Sequence Type genomic DNA
Unitrap ID UNI11185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88813605..88814077 439
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]


Sequence tag IST15112H1HMF1
Sequence
GCCCTACTGACTTCTCTTTGTGTGTATATCTTTCTTTTCCTTATGAGCACAATATACTGAGGTAGATGGATTACCTAAAG
CATCAAGCACTGTCTGAATGGCCTGAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI10506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88813968..88814077 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es