Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14633F11
Clone ID IST14633F11
Vector VICTR74
Project tigm

Sequence tag IST14633F11HMR1
Sequence
TGCGATAGCTTTCTTTTGGACTCAAAATACAAAGCCNAAAGACCGGAGGCATGTTCTTATGAAATGTTGCTGGTGACAAT
TCTAATGGTTTATACTTTTCTCGGAGATGTCACTTCCTCAGACTGCCACAGTGCAGGGTTATGGGTGCATCCTGCTTTTG
TGTTC
Sequence Type genomic DNA
Unitrap ID UNI22091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153173014..153173177 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042548 (Asxl1) NM_001039939 additional sex combs like 1 (Drosophila) Gene [Source:MGI (curated);Acc:Asxl1-001]


Sequence tag IST14633F11HMF2
Sequence
GTCTTGGTTCCTGTTAGTAAGATTCCTACGTTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTC
Sequence Type genomic DNA
Unitrap ID UNI29438 UNI36862 UNI36863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13886782..13886857 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 11096101..11096176 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055493 (Epm2a) NM_010146 epilepsy, progressive myoclonic epilepsy, type 2 gene alpha Gene [Source:MGI Symbol;Acc:MGI:1341085]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70901897..70901972 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 6345128..6345203 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6527053..6527128 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3015070..3015145 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 28215905..28215980 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022262 (Dnahc5) NM_133365 dynein, axonemal, heavy chain 5 Gene [Source:MGI Symbol;Acc:MGI:107718]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 60832043..60832118 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 92872822..92872897 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 18419360..18419435 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 54211350..54211425 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 21414164..21414239 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045967 (Gpr158) NM_001004761 G protein-coupled receptor 158 Gene [Source:MGI (curated);Acc:Gpr158-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3089574..3089649 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8412304..8412379 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 85253398..85253473 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5475166..5475241 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 65186275..65186350 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 45062672..45062747 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 6748395..6748470 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 44349247..44349322 76
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 974303..974378 76
NO GENE  

 
Come back to gene ENSMUSG00000045967


For any suggestions or comments, please send an email to unitrap@crg.es