Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14229F12
Clone ID IST14229F12
Vector VICTR74
Project tigm

Sequence tag IST14229F12BBF1
Sequence
ATAGAAGGAGAGAAAAACCAACTCCTTGGGTTGTGTTCCAACTCCACACAAGCACCCCGGCACACACTCCCCTGCCCTAT
AAATAAATAAATGTAATAAAAGTTTTAATAAAAAAGAGAAATGAGCCTTTTGTGTGTGCAACACCCCAGCCGTCTCTCCG
GGCTGCCTTACCTGANTTGCTTGNCATANCTGANCTCAATCTCCGTCCTCTCCTTGACAAACTTGANGTATTTCTCAAGA
ATATCNATTCCCCACTGTGTATGTTTTTCCAAGTTGTCAAACTGATCCTGTTTGAAAAGANANAGAGAANGGGGAAGTTT
ATTGTCTCTCTCTATGGCTTCCAGTTCCNNGGAGCCNCCCTCTCCATCATTCACTGGTCCAANACAGCGGCTCTANCATT
TTNNNTGATGCCNCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14229F12HMF1
Sequence
ATAGAAGGAGAGAAAAACCAACTCCTTGGGTTGTGTTCCAACTCCACACAAGCACCCCGGCACACACTCCCCTGCCCTAT
AAATAAATAAATGTAATAAAAGTTTTAATAAAAAAGAGAAATGAGCCTTTTGTGTGTGCAACACCCCAGCCGTCTCTCCG
GGCTGCCTTACCTGAGTTGCTTGGCATAGCTGAGCTCAATCTCCGTCCTCTCCTTGACAAACTTGATGTATTTCTCAAGA
ATATCNATTCNNNNNTGTGTATGTTTTTCCAAGTTGTCAAACTGATCCTGTTTGAAAAGAGAGAGNNNNNNGGGAAGTTN
ATTGTCTCNCNCTATGGCTTCCAGTTCCANGGAGCNNCCCTCNCNNTCATTCNCTGNTCCNNNACANCGGCTCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14229F12HMR1
Sequence
TATGGTGTGAGTCCTGGGGATTGAACTCAGATCATCAAGCTTGGCAGCAAGCCTCCCCACCCCACCCCTGCCCCCATCTT
GCCTGCCAGAAGCAAGCAAGCATGATTTCTGTTCTCATTTCACTGTGTGTGTGTGTGTGTGTCTGTGTGANAGANGGANA
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGANAN
Sequence Type genomic DNA
Unitrap ID UNI6780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30960402..30960593 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es