Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12574D7
Clone ID IST12574D7
Vector VICTR76
Project tigm

Sequence tag IST12574D7BBF1
Sequence
CTGTCATTGTCACTTTCACTTTTAAATTATTGTTAATGTATGAATTTCATTGCAGGTTTTTTTCAGGACTTCCCCAGTAA
GAAGTANAGATGGCTGTAGTGGGTATTGCATGCATAATTGAATATACAAAGAAAGGATGCTGGGCCTTTAAAATGGAAAA
TACTTGGTCTACAGGACTAGAATATTCTTTTAAATGTAAATTTTCCAGACTTGGGCTTTGTCTGCTTGTAGGGTGTAACA
GATGAGTTTGGAAGGTTTCAGCTGTCTGAGTCATTTGCTCTGTGATCACACAGTGAAGGAGCTGCTGTTGCCCTGAGGCC
CAGCTGGGTTTTCCATGCTAATGAGGGACTCTGGGCAGGCCTAACCATCAGGAACACTAGGAGAAGTTAGGTAGCTTGCT
GGTTCTTTAAAGGATTCTCCTCAGATGCATGTGTTACAAGCTGCCTGGAAGACCACAAGCCATCCCCTGGTTATTATAGT
AATGTCCATTGANANTNCAGGANGANCAANTCTGCANANCTATTTGAGTCTGANCTGCTGGTTCTAAATGGAN
Sequence Type genomic DNA
Unitrap ID UNI30717

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177357913..177358464 532
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078865 (OTTMUSG00000016574) predicted gene, OTTMUSG00000016574 Gene [Source:MGI Symbol;Acc:MGI:3649838]

 
Come back to gene ENSMUSG00000078865


For any suggestions or comments, please send an email to unitrap@crg.es