Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14406D5
Clone ID IST14406D5
Vector VICTR74
Project tigm

Sequence tag IST14406D5BBF1
Sequence
GAACCAACTAGGTCCTCCGAGGGGGCAGCTTGGTCGGGCCGGGCCAGGCCTGGGGGATAATGGGGCTCCCCTCTTAAGCC
GGCGCCCCTCAGCTTACACATTCGCGACGGCTTTTTGTTTGTTTTTCTGAGTCCCTACACAGTAAACACTTGCCCTGGGG
CTAGCGATGGGAGGAGACGTTCCACGGGAAACCGGCCACGGCTTCTCGAGCCGCCATCAGACACCTCGCTTCACGCGCCT
TCGGGGTGATGGGCTCCAGGCCCAGCCGCGGTCCCCTTCGGGCCCTCGGANGCCCTAGGCCCGGCCCACGTGGCGAGAGA
CCCGGAGCACCCGGCCCCGACAACCACCACACAAAGGAGGCCTGGACGGGCTCTGCACGCCTCAGCTACCGCGAGGCCCT
CGCGCGCAACGCGGCCGCCAAAAGGTTCCAGANNAGCCCGCCTANTGGGGGAGGGGAAGGGAACGCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4998385..4998856 460
 
EST/CDNA Est Name
  BI158169.1 - AA080237.1 - BF163529.1 - BQ948961.1 - CF726025.1 - BM461027.1 - CA750838.1 - BI102779.1 - BG972832.1 - BQ955611.1 - BQ964831.1 - DN174855.1 - BY744673.1 - CJ092831.1 - CN676773.1 - BF160713.1 - BQ963512.1 - BY743216.1 - CJ137124.1 - BU516579


Sequence tag IST14406D5HMF1
Sequence
GAACCAACTAGGTCCTCCGAGGGGGCAGCTTGGTCGGGCCGGGCCAGGCCTGGGGGATAATGGGGCTCCCCTCTTAAGCC
GGCGCCCCTCAGCTTACACATTCGCGACGGCTTTTTGTTTGTTTTTCTGAGTCCCTACACAGTAAACACTTGCCCTGGGG
CTAGCGATGGGAGGAGACGTTCCACGGGAAACCGGCCACGGCTTCTCGAGCCGCCATCAGACACCTCGCTTCACGCGCCT
TCGGGGTGATGGGCTCCAGGCCCAGCCGCGGTCCCCTTCGGGCCCTCGGAGGCCCTAGGCCCGGCCCACGTGGCGAGAGA
CCCGGAGCACCCGGCCCCGACAACCACCACACAAAGGANGCCTGGACGGGCTCTGCACGCCTCAGCTACCGCGAGGCCCT
CGCGCGCAACGCGGCCGCCNAANNNTCCAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4998385..4998806 418
 
EST/CDNA Est Name
  AA080237.1 - CN718710.1 - BF139966.1 - BB626856.1 - BG802953.1 - BE380763.1 - CA883460.1 - CN672152.1 - BU514023.1 - CF170544.1 - CD551196.1 - CA579029.1 - CA874659.1 - CA579094.1 - CK393497.1 - BF164629.1 - CA548122.1 - CD554724.1 - CF160701.1 - CX227043


Sequence tag IST14406D5HMR1
Sequence
GTTCCCCTAAATCTTCGTGCTCCCCACTCAANNGGCTTCGATTTAATCATGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4998334..4998388 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]

 
Come back to gene ENSMUSG00000009079


For any suggestions or comments, please send an email to unitrap@crg.es