Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST422688
Clone ID OST422688
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST422688
Sequence
TGAGGAACCTGGCAAGNCTCAGAAAACAGGAAAGAAGTTGCTGGTTCCGGTAAACGGAAACGACTCAGCTGACGACCTGA
AGTTTATCTTCGAGTATTGTTCGGACATAGTGCCCTTTGACTCCTGGAACCGTCTCATGCGGCAGTTGGGCCTCACAGAC
AATCAAATCCAAATGGTCAGAGCCGAAACACTGGTCACACNGTGAGGCCCTGTACCAAATGCTGCTCAAGTGGCGCCACC
AGACTGGGCGAAGTGCCTCCATCAACCATCTGCTGGATGCCTTGGAAGCCGTGGAAGAGAGAGATGCCATGGAGAAAATT
GAAGACTACGCAGTGAAATCCGGGAGGTTTACTTATCAGAACGCTGCAGCCCAACCAGAGACAGGGCCAGGAGGATCTCA
GTGCGTTTGAAGTCAGCCTGATCTACTTAGTGAACTCAGGACAGCCAAGGCTATGTAGAGAGCCCCGAAGATGCAGGCTC
TTCAGTATTATGAGAATGTACTTAATTTTTTCTTGTAGTAGTTAGTGTATCATATTATTGTATTATTGC
Sequence Type mRNA
Unitrap ID UNI18480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 70180309..70182510 468
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022074 (Tnfrsf10b) NM_020275 tumor necrosis factor receptor superfamily, member 10b Gene [Source:MGI Symbol;Acc:MGI:1341090]

 
Come back to gene ENSMUSG00000022074


For any suggestions or comments, please send an email to unitrap@crg.es