Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14022F11
Clone ID IST14022F11
Vector VICTR74
Project tigm

Sequence tag IST14022F11BBF1
Sequence
CCCANNNNNNGGAACTTACTGTCTTCTTGGGACCTGCAGCCCGGGGGATCTCAAAAACAAGAAGGGAGGGAGGGAGANGN
NAAGGTCAAGGGAAAGAGGAGGAGGAGGAGGAGGAAAGGGAGTGGGGGAAGCGTGTAATCAGATACAGAAGCTAAAGTCC
CTTGTCCTGGAGCTCAGGTGAGAGAAGACCCAGCATTAGCTGGAAGAGAGCCTCAGAGCAAGTCCACACTGCAGGGCANA
AATGGCTGCTGGGAGGCTGAGCGAAGCAGGAGCATTTCCCCCGTCACACCCCAGGGANAAGACAGAANAGGGGGCCCAGT
CNCAGCTGANAGAGTAAACAGANNGGTCTAGAAAGCCTTGCCTTCTTTTTTTCGAGACAGGGTTTCTCTGTATAGCCCTG
GCTGTCCTGNNNTTCACTTTGTANNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 139953446..139953822 351
 
EST/CDNA Est Name
  DN176908.1 - CA885477.1 - CD552680.1 - BE291233.1 - CN695254.1 - CN714393.1 - CF916007.1 - BY015488.1 - BB866636.1 - BB866739.1 - BB853429.1


Sequence tag IST14022F11HMF2
Sequence
CCCTCAGCCTCGATGTTCCCAGCCTGACCCGGGCGGGGTGGGGGAAGGGGCTTTCACGTCAGCGAAGATCAGAATGACTG
TCACCAGGAGGCTCTGGGCCATGTGCCCTAAAGCCTGTTCTTGTATCAAGGGTTGTTTGTGCCTGGAGGAGCCTTGGAGT
TTGTTTGGCCTTTGTTACACTATCTTATGTGGCTGCCTGCCGGAGGTGGAAGTAGGGACACAGGGAGACTGGACCTGCCT
TATCCTGATTCAACACAAATAGATATAATGCTCCACTCAACAGTTTTGTGACTGTATCCCCCAGGCACAGCACAGCTGCC
TGTCTACATAACTGTCTGANNAACAAATTTGGAAGTGANCCNACGTGTGGGAGTAAAGACTCCTGANTTCTTCCCCTAGA
CCCNGGCTGCTCTGANTGAGAACTGANCCNTGCATGGGTCCCTCCNANCNNNGCTGNCTGANANGACTTGTGTGACANAN
GAN
Sequence Type genomic DNA
Unitrap ID UNI28195

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107642166..107642647 444
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033685 (Ucp2) NM_011671 uncoupling protein 2 (mitochondrial, proton carrier) Gene [Source:MGI (curated);Acc:Ucp2-001]

 
Come back to gene ENSMUSG00000033685


For any suggestions or comments, please send an email to unitrap@crg.es