Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14345D12
Clone ID IST14345D12
Vector VICTR74
Project tigm

Sequence tag IST14345D12BBF1
Sequence
TAGCCNACATCACAGAAATTGCAAAAGATTCAGAGGTTCTGACGGTTTAAAATTATCTCCTTTGTAATATCATGGGTTAC
AATCACTCTGTGACAACTGTAGGTGACTGCTTAATGTAATATCTTATCTGCCTGCCCTTTATAGACTGTAAAAGAAAAAA
GTAAAGGGCCTACCTATTATTTATAGTTTCGTTTTTTGCTTTTTTTACATTTTTACTACTGTGTATGTTCNCCTATTATT
TACAGTTTACNGACAGGCANGCAGGCANGCGGGTANATANAGTGGACANNNNNNANTGTGTATGTGATGACNNGNNGCNT
GCNTGNNATCNNANCATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14345D12HMF1
Sequence
TAGCCNACATCACAGAAATTGCAAAAGATTCAGAGGTTCTGACGGTTTAAAATTATCTCCTTTGTAATATCATGGGTTAC
AATCACTCTGTGACAACTGTAGGTGACTGCTTAATGTAATATCTTATCTGCCTGCCCTTTATAGACTGTAAAAGAAAAAA
GTAAAGGGCCTACCTATTATTTATAGTTTCGTTTTTTGCTTTTTTTACATTTTTACTACTGTGTATGTTCGCCTATTATT
TACAGTTTACGGACAGGCANGCANGCAGGCGGGTANATAGAGTGGACATGTATNANTGTGTATGTGATGACATGGTGCAT
GCATGGAATCNNAGCNTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22019243..22019580 320
 
EST/CDNA Est Name
  BM202440.2


Sequence tag IST14345D12HMR1
Sequence
GCTATACTATGGAAGAATGGTTTTTGTTCTTATGGGAATTTGTGGAAACTACACCAATTGAAGCTCTGTATAGTACTTAG
GCAGCAGCATGTTGAGACACAGCTCANANCANAGAAGTGTTTGTGTTTTGAGACAGGGCTATAACCTGGCTAGCCTAGAA
AATCGCTGGCTCCTGGTCATTCTGTGCCTTCTTTCCAAGTGCTGGGATTTAAAAAACACGCTACCNTGCCTGCTTTCTAN
TACTTTCTTTGTTTTAACTGGTGTGTGTGTGTGTGTNCNCN
Sequence Type genomic DNA
Unitrap ID UNI2398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22019577..22019852 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027630 (AC121108.12) NM_030732 F-box-like/WD repeat-containing protein TBL1XR1 (Transducin beta-like 1X-related protein 1)(Nuclear receptor corepressor/HDAC3 complex subunit TBLR1)(TBL1-related protein 1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHJ5]

 
Come back to gene ENSMUSG00000027630


For any suggestions or comments, please send an email to unitrap@crg.es