Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10129E7
Clone ID IST10129E7
Vector VICTR76
Project tigm

Sequence tag IST10129E7HMF1
Sequence
TTATGAGCAGGTTCTTCCTGCAGTTGGAAAGATTCTNGCTGGGGATNNNTCTNTANGAAACAGGGGGGGAATAAAGCCTC
ACCCCCCCCTTGCTTCTGCTGATACAAAATAAAACAAAAACTGCCACCACCTCTCTGCCCTCCATCACCACCAACTCCCA
TCTCAGGACAAACAGCTCCTTTCCCAAATCCTTACTTTAGGACTCCAGGATANATCTAGATGATAAACGTCATACAACCC
CANAGAAGGTTGTACCCCAGCCTANGCTCCTTTATGGACCACACNNANGTCANCCCCANAATAAGAATGGAACANAGTGC
CCAAACATNATGAAAGCAGCCCCGTGCTTTATAACACAAGCTTCCAGTACCATTTCTNACGTGGAACCCTGTGTCATCAG
TACCTACATATACNAACAACATATAAGACAAATCCTANGGCTCCACTTGAGTGACACTGTCCCACTGTGACACAAAGACA
CTACCACACAATGTNNATAAGTNNGANGAAATGATACNNNTGCNCCTTGCACANTGACNCNCANGCNCGTCNCCNNNGTN
ACNANGTTNCANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10129E7BBR1
Sequence
ATGCGTCTTACCAGTCCTGGTGGCTGCACTGACTGCTCGCCGTCTACCAGCTACAGGAGTCACACGGGCTTTTGAGATGG
TCTAGGGTGGGCATAGTGAGCCTTTGTGTTTGTCTTCTCATTTGGAATAGCTGCAGTTTCCAGCCAGGGTGCCCTGTCTT
CTGCCTCATGTCTCTTCTTCAACTTCTGTCTCCAGTCCTTGCCCCTATCAGTACCCACTCAGTGCTCTGCCTCACCAGGC
CTGTTTCTCTTACCCAAGGCTCTGTGTGCCCAGACCCTGCAGTGTCTGTCTTGATACCCCACCCCCACTCTCTGCAGCAC
TAGCTAGCTCACTAGCTCTCAGCAGCACCCGTCTCCTGTGGCTGCAGCCCCGTTGGCCCAGGGCCCGGCCCTTACAGTAA
CTCATCGGGCTGATGGAGGCGACTTTGATGAACAAGCCTCCCCTCCCCCTGTGGGGGCCTGACTCGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGTGTG
Sequence Type genomic DNA
Unitrap ID UNI17203

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41624397..41624903 505
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028444 (Cntfr) NM_016673 ciliary neurotrophic factor receptor Gene [Source:MGI (curated);Acc:Cntfr-002]

 
Come back to gene ENSMUSG00000028444


For any suggestions or comments, please send an email to unitrap@crg.es