Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14209C5
Clone ID IST14209C5
Vector VICTR74
Project tigm

Sequence tag IST14209C5BBF1
Sequence
GCTGTCGCGTTAAGCGCGACTCAAATGCTAGCCTACCAGGTCCCTCTGGAGTGGGGTGACTCAGGGGCGACAGCTGCAGA
AGGAGGCCGAGGGGCGGCAAGCGAGATGCCAGGCGGGCTCCTCTGANCNNCNGNTGGNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 126889231..126889367 127
NO GENE  


Sequence tag IST14209C5HMF1
Sequence
GCTGTCGCGTTAAGCGCGACTCAAATGCTAGCCTACCAGGTCCCTCTGGAGTGGGGTGACTCAGGGGCGACAGCTGCAGA
AGGAGGCCGAGGGGCGGCAAGCGAGATGCCAGGCGGGCTCCTCTGAGCAGCGGGTGGCTCTCACCGGAGACTGGCGACGA
GCACCCACCCNATCGCGCTGCCCTCTGTCNGATCTCNTCCTCTCCCGCANCCATGCATGACAGTGGCCCCCATCGTCCCC
GTCCTTCNTCTCTGCCCCGCNNGACGTCNCNAACCACTNNNCTGATAGGACGCACCNTGNTGCCNTGCCTANANCANCAN
TGCTNTGGAGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14209C5HMR1
Sequence
CAGCGAGCGACCGCGTTAAGTGGCTGTCATACGTTGAGCGATACAGAAAAAGCAGGTGTGCCTATTCCCTCAAATCCCTA
GGCAGAGAGGCCCATTTAACTTCCAGCTCAAGCCGTGGTGCCCTGTCACATGACCCCCAGTTCCTATCTGCTTTCCTTTA
NACTGTTGGAATCTCTCTGTGATCACAACCGGGATGCCAGG
Sequence Type genomic DNA
Unitrap ID UNI22141

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 126889034..126889234 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030346 (Rad51ap1) NM_009013 RAD51 associated protein 1 Gene [Source:MGI (curated);Acc:Rad51ap1-001]

 
Come back to gene ENSMUSG00000030346


For any suggestions or comments, please send an email to unitrap@crg.es