Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14714E3
Clone ID IST14714E3
Vector VICTR76
Project tigm

Sequence tag IST14714E3BBF1
Sequence
ATAAGGAGAGTGAAATATTGTGAATTTGTTATGTAATCACTCATGACTGTGCCATGGGTCCGATTAAGGCTATAGCCAGC
AAGTGAAAGTAGATGTCTTGGTACAATACATATGGTGGGGGCAACAGATAGGAAAAGAGCAACAGGAAGTCATCTGAAGC
TCTGGATACTTGCTTAAGACAGATAAAAACCTTCTAAAGATAGGGTTTGGGTTTGGGACATTCCTGGAGAAGGTCGGCAG
ATTTGGAGAAAGTGGGCCNCTGANNCNGAAAATANATTTACCNNNACAAANAAAGATGGTGAANTCNNAAGATGAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14714E3HMF1
Sequence
ATAAGGAGAGTGAAATATTGTGAATTTGTTATGTAATCACTCATGACTGTGCCATGGGTCCGATTAAGGCTATAGCCAGC
AAGTGAAAGTAGATGTCTTGGTACAATACATATGGTGGGGGCAACAGATAGGAAAAGAGCAACAGGAAGTCATCTGAAGC
TCTGGATACTTGCTTAAGACAGATAAAAACCTTCTAAAGATAGGGTTTGGGTTTGGGACATTCCTGGAGAAGGTCGGCAG
ATTTGGAGAAAGTGGGCCACTGAAACAGAAAATAGATTTACCTAAGCAAAGAAAGATGGTGAAGTCAAAAGATGAGCTTC
TCAACAAACAAACAAACATATTANCANATAAATATACATTCTTGGAATGAAGGAAAATAAAAGGTAAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 110478401..110478793 389
NO GENE  


Sequence tag IST14714E3HMR1
Sequence
NNNTATGCCTTACACAATCTTANTTTTAATTAAAACCTCATAAATTAAAAAATGAAATTATTCTATTTGTGTTCTTGTAA
TATATGTCAGATTTTAAGGATAAGGATTGCGTATTTAGTCTGCGGCTGTTCCTCAAATACTGACTACATATTATGTTCCA
GCANAAAGAGC
Sequence Type genomic DNA
Unitrap ID UNI36872

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 110478791..110478957 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074662 (CT025605.11)  

 
Come back to gene ENSMUSG00000074662


For any suggestions or comments, please send an email to unitrap@crg.es