Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST422419
Clone ID OST422419
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST422419
Sequence
TGAGGAACCAGTGTATCAGCCNGATGACCGAGGTGAAGGAACAGTGTGACGAGCGGATAGAGGAGGTCATCAGAAAGCGA
AACGAAGCACCGGGTTCCAGAGACCTGGCTGAAACCAACAACCAACATCAGCAGGCCCTCAAGCCTCAGCCCAAGCNNTC
AGGAAGAAGTCCCATCAGAGGAACAGATGCCACAAGAGAAAGGGGATGTGCCCAGAAACAAGTCCCAGATTCCAGCCCCC
AATTCAGAGAGCTTGGGTTTGAAGCCACAGGTGCAGAATGAGGAAACCAATGAGATTCAGGCTGTCGGTGAGGAGCACCA
ACAGGCATCCATCCAAGGGCAGGCGGTGGCGGATGGCACTCGGGTAGGAGCTGAGAAACTCGATCAGCACACACAGCTAC
CAGCTGGCCTGTTGGCCAGGCCTGAGGAGGACTCTCAGTACCCTGAGCGGGAGCAGCTTGTCATCCGGGATAGGCAGGAG
CAGCAGCGTGCATCAGAGG
Sequence Type mRNA
Unitrap ID UNI10611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59741484..59746585 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021556 (Golm1) NM_001035122 golgi membrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917329]

 
Come back to gene ENSMUSG00000021556


For any suggestions or comments, please send an email to unitrap@crg.es