Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST422390
Clone ID OST422390
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST422390
Sequence
GGAGGCAACGACCATTTTAACTTTACTGGCCTTCCTCCTGCACCAGCTGCCTCAGGACTGAAACCCTCTCCTTCCTCGGG
GGAGGGCCTCTACACTAACGGGTCTCCCATGAACTTCCCCCAGCAAGGGAAAAGTTTGAATGGGGATGTGAATGTTAATG
GCTTATCTACTGTATCTCACACTACTACTTCAGGGATTTTGAACTCTGCTCCCCACTCCTCTAGCAC
Sequence Type mRNA
Unitrap ID UNI951

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127545954..127547904 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040054 (Baz2a) NM_054078 bromodomain adjacent to zinc finger domain, 2A Gene [Source:MGI Symbol;Acc:MGI:2151152]

 
Come back to gene ENSMUSG00000040054


For any suggestions or comments, please send an email to unitrap@crg.es