Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W035F03
Clone ID W035F03
Vector pT1betageo
Project ggtc

Sequence tag W035F03
Sequence
CATATGATTCATCATGTATACCATCTCTCATGGGAAAATACTATGCTGTCAATTTTCCCATGAGAGATGGTATAGATGAT
GAATCATATGGACAAATTTTTAAGCCTATCATCTCAAAAGTGATGGAGATGTACCAGCCTAGCGCGGTGGTGCTGCAGTG
TGGCGCAGACTCCCTGTCTGGGGACAGGGTTGGTTGTTTCAATGTAACTGTCAAAG
Sequence Type mRNA
Unitrap ID UNI36876

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 36713431..36713690 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019777 (Hdac2) NM_008229 histone deacetylase 2 Gene [Source:MGI (curated);Acc:Hdac2-001]

 
Come back to gene ENSMUSG00000019777


For any suggestions or comments, please send an email to unitrap@crg.es