Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W009G12
Clone ID W009G12
Vector pT1betageo
Project ggtc

Sequence tag W009G12
Sequence
AGCGTGGAAACTACCCGGTCAAAGGATGCTGAGTCCCGAGCGCCTAGCTCTACCGGACTACGAGTATCTGGCTCAGAGAC
ATGTCCTCACGTACATGGAGGATGCAGTGTNCCAGCTGCTGGAGAACAGGGAGGATATTAGCCAGTATGGCATTGCCCGG
TTCTTCACTGACTATTTTAACAGCGTATGCCAAGGAACTCACATTCTCTTCCGGGAATTCAGCTTTATACAAGCCACACC
TCATAATAGAGCATCATTCCTTCGGGCCTTCTGGAGATGCTTTCGAACTGTAGGGAAAAATGGTG
Sequence Type mRNA
Unitrap ID UNI36878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91223886..91284796 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040591 (1110051M20Rik) NM_175123 RIKEN cDNA 1110051M20 gene Gene [Source:MGI Symbol;Acc:MGI:1915079]

 
Come back to gene ENSMUSG00000040591


For any suggestions or comments, please send an email to unitrap@crg.es