Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST422305
Clone ID OST422305
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST422305
Sequence
CCCATCATCCCCCTTGTCGCCCGGATCTCAGACCAGAATGCTTCTGGGGCTCCTCCAATGACAGTCCGGGAGAAAACNGC
CGCCTGGAAAAGTTTCNGCCAGCTGCTTTCCAGNCACAACACCTGACCTANANGAATTGAGGAAGTGGAGCTGGCCAGGC
NTTCCCAGGGAAGTTCGACCAGTGACCTGGAGACTGCTGCCGGGCTATCTCCCGGCAAACACCGAGCGGNGGAAGTTGAC
CNTGCAGCGGAAGCGGNAGGAGTACTTTGGCTNNATTGAGCANGATTATGACTCTCGGAATGAAGAGCACCACCAGGATA
CCTACA
Sequence Type mRNA
Unitrap ID UNI18503

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29707585..29710038 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042203 (Tbc1d22b) NM_198647 TBC1 domain family, member 22B Gene [Source:MGI Symbol;Acc:MGI:2681867]

 
Come back to gene ENSMUSG00000042203


For any suggestions or comments, please send an email to unitrap@crg.es